Student Solution

-->

"Education is the most powerful weapon which you can use to change the world”
– Nelson Mandela

1 University

1 Course

2 Subjects

Download Solution

Related Solution

Chapter 14 Discussio...
It enhances an effective government. This is because each subnational government has been assigned its specific roles and responsibilities and therefore focuses on the specific tasks assigned. It enco...

Chapter 14 Discussion
Chapter 14 Discussion

It enhances an effective government. This is becau

Discussion 4_1672919...
First and foremost, this is a really great question. I would start by quoting my mother and what I grew up hearing in my household. My mother use to say " Do onto others as you would have them to do...

Discussion 4
Discussion 4

First and foremost, this is a really great questio

Lab 4 Wireshark_1655...
1. What 3 TCP protocols can be found in this pcap? Hint: Go to Statistics-> Protocol Hierarchy Look at the protocols that fall under TCP SSH Protocol, MySQL Protocol, and Internet Relay Chat 2. How m...

Lab 4 Wireshark
Lab 4 Wireshark

1. What 3 TCP protocols can be found in this pcap?

Critical Thinking 4 Chapters 6,9-10

Critical Thinking 4 Chapters 6,9-10

Q 1. The sequence above is DNA. (5 points) a. What is the complimentary DNA strand? b. What is the mRNA strand? Use your DNA 3’-5’ strand as the templatec. What is the amino acid sequence? d. What is the result of a mutation in the 6th C to a G (blue arrow)? Name of mutation and any changes to the amino acid.e. What is the result of a mutation in the 3rd T to a A? Name of mutation and any changes to the amino acid sequence.

View Related Questions

Solution Preview

View Complete Solution
3’ GGTTCCGTACGATATATTATTGG 5’ mRNA is SS molecule that carries information from DNA and carry it further to make proteins. For DNA 3’-5’, mRNA will be CCAAGGCAUGCUAUAUAAUAACCPro-Arg-His-Ala-Ile-Ile-ThrThis change will change the sequence of amino acid replacing Alanine with Glycine, hence altering the final product i.e., protein. This type of mutation is called as ‘Point Mutation’.This change will change the sequence of amino acid replacing isoleucine with Lysine, hence altering the final product i.e., protein. This type of mutation is called as ‘Point Mutation’.