Student Solution

-->

"Education is the most powerful weapon which you can use to change the world”
– Nelson Mandela

1 University

1 Course

2 Subjects

Download Solution

Related Solution

Discussion Board 3_1...
I have experienced at least three of these cognitive distortions which are: Magical thinking: This is when we connect unrelated situations. I can actually relate to the example given in the handout. I...

Discussion Board 3
Discussion Board 3

I have experienced at least three of these cogniti

3-1 Discussion_16504...
Different generations working for the same department has its own set of pros and cons. Amongst the advantages, people of different generations can provide separate approaches to problem solving. Diff...

3-1 Discussion
3-1 Discussion

Different generations working for the same departm

Paper 4 - Chapter 4_...
Your culture plays a huge role in socialization. Different countries have different beliefs and roles. Each country has their own opinion and way of handling things than the United States. Compared to...

Paper 4 Chapter 4
Paper 4 Chapter 4

Your culture plays a huge role in socialization. D

Critical Thinking 4 Chapters 6,9-10

Critical Thinking 4 Chapters 6,9-10

Q 1. The sequence above is DNA. (5 points) a. What is the complimentary DNA strand? b. What is the mRNA strand? Use your DNA 3’-5’ strand as the templatec. What is the amino acid sequence? d. What is the result of a mutation in the 6th C to a G (blue arrow)? Name of mutation and any changes to the amino acid.e. What is the result of a mutation in the 3rd T to a A? Name of mutation and any changes to the amino acid sequence.

View Related Questions

Solution Preview

View Complete Solution
3’ GGTTCCGTACGATATATTATTGG 5’ mRNA is SS molecule that carries information from DNA and carry it further to make proteins. For DNA 3’-5’, mRNA will be CCAAGGCAUGCUAUAUAAUAACCPro-Arg-His-Ala-Ile-Ile-ThrThis change will change the sequence of amino acid replacing Alanine with Glycine, hence altering the final product i.e., protein. This type of mutation is called as ‘Point Mutation’.This change will change the sequence of amino acid replacing isoleucine with Lysine, hence altering the final product i.e., protein. This type of mutation is called as ‘Point Mutation’.