Student Solution

-->

"Education is the most powerful weapon which you can use to change the world”
– Nelson Mandela

1 University

1 Course

2 Subjects

Critical Thinking 4 Chapters 6,9-10

Critical Thinking 4 Chapters 6,9-10

Q 1. The sequence above is DNA. (5 points) a. What is the complimentary DNA strand? b. What is the mRNA strand? Use your DNA 3’-5’ strand as the templatec. What is the amino acid sequence? d. What is the result of a mutation in the 6th C to a G (blue arrow)? Name of mutation and any changes to the amino acid.e. What is the result of a mutation in the 3rd T to a A? Name of mutation and any changes to the amino acid sequence.

View Related Questions

Solution Preview

3’ GGTTCCGTACGATATATTATTGG 5’ mRNA is SS molecule that carries information from DNA and carry it further to make proteins. For DNA 3’-5’, mRNA will be CCAAGGCAUGCUAUAUAAUAACCPro-Arg-His-Ala-Ile-Ile-ThrThis change will change the sequence of amino acid replacing Alanine with Glycine, hence altering the final product i.e., protein. This type of mutation is called as ‘Point Mutation’.This change will change the sequence of amino acid replacing isoleucine with Lysine, hence altering the final product i.e., protein. This type of mutation is called as ‘Point Mutation’.
WhatsApp