Student Solution

-->

"Education is the most powerful weapon which you can use to change the world”
– Nelson Mandela

1 University

1 Course

2 Subjects

Download Solution

Related Solution

Chapter 20 Forum_163...
In the United States, the Uniform Commercial Code (UCC) offers assurance identified with guarantees of title by the vender, the title being passed on is a decent title and that the merchant has the pr...

Chapter 20 Forum
Chapter 20 Forum

In the United States, the Uniform Commercial Code

Week 3 Discussion_16...
The above quote from Dr. Mark Ragins encapsulates in a basic manner the principles of a recovery-based approach to treating mental illness. As we are learning throughout the modules, evidence-based pr...

Week 3 Discussion
Week 3 Discussion

The above quote from Dr. Mark Ragins encapsulates

Midterm_1680590672.d...
The Medical Model and the Social Model are two different ways of understanding disability. The Medical Model views disability as an individual problem that requires medical diagnosis and treatment. It...

Midterm
Midterm

The Medical Model and the Social Model are two dif

Critical Thinking 4 Chapters 6,9-10

Critical Thinking 4 Chapters 6,9-10

Q 1. The sequence above is DNA. (5 points) a. What is the complimentary DNA strand? b. What is the mRNA strand? Use your DNA 3’-5’ strand as the templatec. What is the amino acid sequence? d. What is the result of a mutation in the 6th C to a G (blue arrow)? Name of mutation and any changes to the amino acid.e. What is the result of a mutation in the 3rd T to a A? Name of mutation and any changes to the amino acid sequence.

View Related Questions

Solution Preview

View Complete Solution
3’ GGTTCCGTACGATATATTATTGG 5’ mRNA is SS molecule that carries information from DNA and carry it further to make proteins. For DNA 3’-5’, mRNA will be CCAAGGCAUGCUAUAUAAUAACCPro-Arg-His-Ala-Ile-Ile-ThrThis change will change the sequence of amino acid replacing Alanine with Glycine, hence altering the final product i.e., protein. This type of mutation is called as ‘Point Mutation’.This change will change the sequence of amino acid replacing isoleucine with Lysine, hence altering the final product i.e., protein. This type of mutation is called as ‘Point Mutation’.